Close Menu
  • Home
  • AI
  • Big Data
  • Cloud Computing
  • iOS Development
  • IoT
  • IT/ Cybersecurity
  • Tech
    • Nanotechnology
    • Green Technology
    • Apple
    • Software Development
    • Software Engineering

Subscribe to Updates

Get the latest technology news from Bigteetechhub about IT, Cybersecurity and Big Data.

    What's Hot

    Zane Maldonado LattePanda IOTA-Powered CG Deck Moves from Dream to Engineering Prototype

    May 26, 2026

    How Agentic AI Is Changing Network Traffic: Cisco Report

    May 26, 2026

    Apple’s incredible AirPods Pro 3 drop back below $200

    May 26, 2026
    Facebook X (Twitter) Instagram
    Facebook X (Twitter) Instagram
    Big Tee Tech Hub
    • Home
    • AI
    • Big Data
    • Cloud Computing
    • iOS Development
    • IoT
    • IT/ Cybersecurity
    • Tech
      • Nanotechnology
      • Green Technology
      • Apple
      • Software Development
      • Software Engineering
    Big Tee Tech Hub
    Home»Nanotechnology»Lipid nanoparticles-mRNA based on the consensus sequences of avian coronavirus S1 and N genes protect animals against multiple viral infections | Journal of Nanobiotechnology
    Nanotechnology

    Lipid nanoparticles-mRNA based on the consensus sequences of avian coronavirus S1 and N genes protect animals against multiple viral infections | Journal of Nanobiotechnology

    big tee tech hubBy big tee tech hubAugust 30, 20250824 Mins Read
    Share Facebook Twitter Pinterest Copy Link LinkedIn Tumblr Email Telegram WhatsApp
    Follow Us
    Google News Flipboard
    Lipid nanoparticles-mRNA based on the consensus sequences of avian coronavirus S1 and N genes protect animals against multiple viral infections | Journal of Nanobiotechnology
    Share
    Facebook Twitter LinkedIn Pinterest Email Copy Link

    [ad_1]

    The widespread prevalence of IBV has caused huge economic losses to the global poultry industry, and the complexity and diversity of viral mutations and recombinations have complicated the prevention and control of IBV infections [43, 44]. Therefore, the development of novel broad-spectrum vaccines against multiple genotypes of IBV is necessary. Like in other coronaviruses, the IBV S1 and N genes encode important protective antigens that induce humoral and cellular immunity and have been used as targets in the development of coronavirus vaccines [45]. Consensus sequences can cover common viral mutations for broad-spectrum protection, and DNA vaccines based on consensus sequence strategies for the IBV S gene protect against infections with homologous and heterologous IBVs [46]. Therefore, in this study, four S1 consensus sequences capable of covering common viral mutations and one N consensus sequence for all genotypes were designed using bioinformatics methods for the endemic IBV strains with GI19, GI13, GI7, and GVI1 genotypes, and their promising properties as candidate antigens were verified using protein secondary structure analysis and tertiary structure modeling. mRNA vaccines against Marek’s virus and H9 subtype avian influenza viruses elicited efficient immune responses in chickens [47, 48]. Therefore, in this study, four dual-antigenic monovalent mRNA vaccines and one penta-antigenic quadrivalent mRNA vaccine were constructed based on the mRNA-LNP vaccine platform, and the correct expression of antigenic proteins was verified in vitro and in vivo. As the IBV N protein is highly conserved and has good immunogenicity, we added this antigen to each monovalent and quadrivalent vaccine to enhance the immunogenicity of these vaccines. Vaccine safety is an important consideration in vaccine development. Acute and repeated dose toxicity studies of SARS-CoV-2 monovalent and bivalent mRNA vaccines in rats following intramuscular injection at doses of 50, 200, and 300 µg showed no vaccine-induced toxicological changes in rats [49, 50]. In the current study, SPF chickens were injected intramuscularly with 100 µg of mRNA vaccine. Their behavior remained normal during the 14-day monitoring period, and no inflammatory reaction or other adverse reactions were noted, indicating that the novel mRNA vaccines possess a good safety profile and might be used as candidate vaccines against IBV. In subsequent animal experiments, it is feasible to administer two 50 µg doses of the mRNA vaccine to SPF chickens as a multivalent vaccine regimen, and this approach will not exceed the tolerance range of SPF chickens.

    Studying the biodistribution of mRNA vaccines is important for understanding vaccine targets and pathways of action. mRNA levels in mice after intramuscular injection were highest in lymph nodes, followed by muscles and the spleen, decreasing to half of their original amounts in muscles within 18 h, whereas lungs and the spleen showed decreased mRNA levels at 16 h and 25 h, respectively [51]. In our study, mRNA was detected in all organs and tissues of SPF chickens 24 h after immunization with the mRNA vaccine, with plasma having the highest mRNA content, followed by muscles. These findings differ considerably from the results in mice, probably because chickens lack lymph nodes, and the spleen assumes the main role as a secondary immune organ. Using western blots, mRNA-expressed proteins were detected in the spleen and liver of SPF chickens. The biopsy results further verified the expression of mRNA in the liver and spleen, and a large amount of antigenic protein was expressed at the injection site. These results suggest that mRNA, as a foreign antigen, enters muscle cells through the injection site, and part of it enters the bloodstream and is distributed throughout the body via the circulatory system, where it is recognized by the immune system and initiates an immune response. Only a few reports exist on the pathways of mRNA vaccines in chickens. Our study confirmed the strong delivery of LNPs in chickens, which supports the development of targeted vaccines and clinical applications of chicken mRNA vaccines.

    Exploring the optimal immunizing dose for novel vaccine platforms is one of the key steps in vaccine development. Different species differently tolerate high doses of mRNA vaccines. Mice and humans respond differently to the same relative dose of mRNA vaccine, with mice tolerating a 1,000-fold higher relative mRNA dose [52]. The usual immunization dose considers the body weight of the animal, the safety of the vaccine, and its immunogenicity [53]. Ensuring the immunogenicity and efficacy of each component is a fundamental challenge in the development of combination vaccines [54]. In this study, two antigens, S1 and N, were included in the monovalent mRNA vaccine, whereas four S1 and one N antigen were included in the quadrivalent vaccine. The vaccine was composed in a 1:1 ratio to ensure that the various antigens can exert their respective immunogenicity. The immunoreactivity of the mRNA vaccine was further evaluated by detecting specific antibody levels and T-cell types at low (1 µg), medium (5 µg), and high (10 µg) vaccine doses. The immunization dose of the mRNA vaccine was positively correlated with the level of specific antibodies, and the secondary immunization with medium or high doses triggered the activation of CD4+ and CD8+ T cells.

    T cells play an important function in the body’s removal of pathogens and elimination of infections [55]. Using T-cell proliferation assays in vitro, we evaluated the T-cell function induced by mRNA vaccines. Our results demonstrated that both CD4+ and CD8+ T cells showed significantly increased proliferation, suggesting that mRNA-induced memory or effector T cells recognize specific antigens and produce effector responses, e.g., cytokine release or the induction of cytotoxicity. IBV triggers the upregulation of several 25 immune-related genes after infection, including many cytotoxicity-related and antiviral natural immunity-associated genes [56]. In the present study, elevated expression levels of IL-2, IL-1β, IFN-γ, and NK lysin in peripheral blood lymphocytes and the spleen after immunization with mRNA vaccines suggest the proliferative activation of T and B cells as well as the activation of cytotoxic T cells, with IL-1β playing a major role in balancing the inflammatory response. Elevated expression levels of TLR3, TLR7, MDA5, and ISG12-2 in peripheral blood lymphocytes suggest the initiation of innate immune responses, which further promote the production of type I interferon and pro-inflammatory cytokines. The upregulation of MX1, OASL, and IRF3/7 in the spleen suggests the activation of the natural antiviral immune response, which induces the secretion of chemokines to regulate the circulation of immune cells and the recruitment of CD8+ T cells to the site of infection. The upregulation of IL-4 in peripheral blood lymphocytes and IL-5 in the spleen suggests the initiation of humoral immune responses, which induce the production of specific antibodies. Changes in the expression levels of immune genes suggest that immunization with mRNA vaccines can elicit an immune response similar to that following viral infection [56, 57].

    Neutralizing antibody levels are an important indicator for evaluating the immunization effect of a vaccine. The mRNA vaccines prepared in this study effectively induced neutralizing antibodies at 5 µg and 10 µg doses. The ELISpot results showed that the monovalent mRNA vaccines had good cross-reactivity in response to homologous or heterologous viruses, possibly because the N protein carries a conserved IBV T-cell epitope, which plays an important role as one of the antigens shared by the four monovalent mRNA vaccines. As good immunogenicity was demonstrated with 5 µg and 10 µg mRNA vaccine, further infection tests were carried out using these two doses. To comprehensively assess the protective power of the novel vaccines, the commercialized IBV inactivated vaccine (strain M41) was selected for comparison. Immunization with 10 µg of an mRNA vaccine induced higher levels of neutralizing antibodies with strong protective effects, as evidenced by the absence of clinical symptoms after infection, 100% survival, high activity of tracheal cilia, less viral shedding, and lower tissue viral load, confirming its great potential as a broad-spectrum candidate vaccine for IBV. Immunization with 5 µg of monovalent or quadrivalent mRNA vaccine was similar to that with inactivated vaccines regarding the reduction of clinical symptoms but provided higher protection than inactivated vaccines in response to infection by the more virulent 210127GXYL(GI13) strain. Cytotoxic T-cell infiltration in the tracheal mucosa during the early stages of IBV infection is closely related to virus clearance [58, 59]. Tracheal cilia scores and electron microscopic observations confirmed in our study that the novel mRNA vaccines protected the trachea better than the inactivated vaccine. ELISpot results showed that immunization with 5 µg mRNA vaccine induced equivalent levels of IFN-γ release as immunization with 10 µg, but the levels of neutralizing antibodies were lower in the 5-µg-immunized group, and therefore the protection against clinical morbidity and mortality was lower in the 5-µg-immunized group than in the 10-µg-immunized group. Although the inactivated vaccine was able to induce some increase in neutralizing antibody levels, it could not stimulate IFN-γ production by T cells. Therefore, chicken in this group exhibited more severe pathological tissue damage and higher viral replication and shedding in response to IBV infection, demonstrating the important role of cytotoxic T cells in clearing IBV infection. After infecting chickens, the IBV strain first replicates in the tracheal mucosa, leading to tracheal cilia damage, followed by a second replication in nonrespiratory tissues, including the kidneys, bursae, and oviducts [60]. Therefore, the ideal vaccine for dealing with the multisystem damage caused by IBV infection should combine the dual protective efficacy of inducing high levels of neutralizing antibodies and stimulating cytotoxic T-cell activation.

    Monovalent and multivalent mRNA vaccines exhibit essentially identical protective efficacy against infection with homologous influenza A and B viruses [61, 62]. However, in our study, in response to infections with the more virulent strain 210127GXYL(GI13), chickens in the quadrivalent 5-µg-immunized group died. As a possible cause, we hypothesized the interference in the expression between the antigenic components after vaccine immunization, resulting in insufficient protein amounts of the antigen GI13 S1 or N, which induced a weaker immune response. Therefore, the quantity and dosage of each component in the multivalent mRNA vaccine need to be adjusted in the future to ensure that each antigen achieves maximum efficacy. Moreover, this study lacked experiments on the effects of mRNA vaccines on chicken mucosal immunity, and it was not possible to determine whether the protective effect on the tracheal mucosa and viral clearance after IBV infection was a result of T-cell cytotoxicity or a major role of sIgA; the specific mechanisms still need to be further investigated. This study has demonstrated that current inactivated vaccines have limited protective efficacy against prevalent IBV strains, which may be attributed to the fact that most of the vaccines sold in the market are predominantly of the GI1 type, with limited cross-protection against other genotypes, which emphasizes the importance of the development of novel broad-spectrum vaccines.

    In conclusion, the four IBV dual-antigenic monovalent mRNA vaccines and the penta-antigenic quadrivalent mRNA vaccine prepared in this study were able to induce IBV-specific humoral and cellular immune responses in chickens and provide significant protection against infections with the IBV strains GI19, GI13, GI7, and GVI1. In practice, the IBV epidemiological situation can be dynamically monitored regionally, and the antigenic components can be matched according to the monitoring results to design a specific mRNA vaccine for the prevention and control of IBV. Furthermore, with the continuous development of bioinformatics technology, future IBV mRNA vaccine designs can be based on the conserved epitopes in the receptor-binding domain (RBD) of the S1 or other structural proteins, and a new type of vaccine can be developed that is more broad-spectrum and highly efficient. Only a few research reports on mRNA vaccines for poultry exist. Our study confirms the great application prospects of mRNA vaccines for chickens, which provides research ideas for the prevention and control of other viral diseases in poultry.

    Methods

    Viruses, cells, animals, and ethics statement

    The IBV strains, 210,197(GI19), 210,127(GI13), 220198GDZC(GI7), and GZ701(GVI1) strain were stored in our laboratory [26]. All strains were propagated in 10-day-old SPF embryonated chicken eggs via the allantoic route. The 50% embryo infectious dose (EID50) of these strains in the harvested allantoic fluid was calculated by applying the Reed and Muench method. Cells from a chicken embryo fibroblast cell line (DF-1 cells) were cultured in Dulbecco modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS). SPF white leghorn chickens and SPF embryonated eggs were purchased from Guangdong Dahuanong Poultry & Egg Co. (Guangzhou, China). Our study was approved by the Animal Welfare and Ethical Censor Committee of South China Agricultural University (SCAU approval number: 2024B158 and 2025B015).

    Generation of consensus sequences and analysis of protein structures

    In this study, we downloaded the S1 gene sequences of IBV GI19, GI13, GI7, and GVI1 genotypes and the N gene sequences of all the genotypes (as of mid-2024) from the National Center for Biotechnology Information (NCBI), which had been isolated from all over the world from 1980 to 2024 (as of mid-2024). To improve comparability and limit bias for identical sequences, duplicate sequences were removed using the phylosuite software, and manual comparisons manually removed sequences whose lengths deviated from the median length value. Format harmonization of sequences across datasets was performed using MEGA 11 software and converted to FASTA format. Multiple sequences were compared using MegAlign software, and the Clustal W method was selected for comparison to analyze the evolutionary relationship of the sequences based on the branching structure and length of the evolutionary tree, and to determine the source of homology and divergence. The physicochemical properties of the vaccines were analyzed using the ExPASy ProtParam tool, which predicted the constructs’ attributes such as length, molecular weight, instability index, theoretical isoelectric point (pI), aliphatic index, estimated half-life, and total average hydrophobicity (GRAVY) [63]. The SOPMA server was used to predict the secondary structure of the vaccine constructs [64]. The tool optimizes multiple predictions from various comparisons using BLAST technology to enhance and characterize the prediction of vaccine secondary structure. Five consensus sequences were analyzed using the online site IEDB to predict B-cell epitopes from protein sequences using a Random Forest algorithm trained on epitope and non-epitope amino acids determined from the crystal structure [65].

    The protein tertiary structures of the four S1 consensus sequences were predicted using AlphaFold3 [66], and the protein prediction results were output to be viewed and analyzed by pairs of protein 3D structure coordinates and confidence scores. The 3D structures of natural S1 proteins of IBV M41 strain (UniProt: P12651) were downloaded from SWISS-MODEL database, and then the four consensus S1 proteins and natural S1 proteins were compared with each other by structural overlap using PyMOL software, and finally the similarity between the consensus S1 proteins and natural S1 proteins was judged by RMSD values. The amino acid sequences of galactoside alpha-2,3-sialyltransferase receptor (Gene ID: 395139) were downloaded from NCBI, and each of the four predicted S1 consensus sequences was predicted from its protein interactions using AlphaFold3, and the predictions were exported and edited for visualization and further analysis using PyMOL software.

    mRNA production and LNP encapsulation

    The mRNA was synthesized by in vitro transcription using T7 RNA polymerase and codon-optimized consensus sequence plasmid DNA templates. Lipid particles contain ionizable lipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), PEG lipids, and cholesterol in ethanol. The lipid mixture was combined with 10-mM citrate buffer (pH 4.0) containing mRNA at a ratio of 1:3 (ethanol to aqueous fraction) using a microfluidic mixer (Yaohai Technology, China). Formulations were dialyzed against phosphate buffer saline (PBS) (pH 7.4) and then concentrated using Amicon ultra centrifugal filters (Millipore, USA) with a 10-kD molecular weight cut-off. All LNP were tested for particle size and polymer dispersity index (PDI). The unencapsulated free RNA was detected using the fluorescent dye method (Thermo Fisher, USA) and the encapsulation rate of LNP-mRNA was calculated by constructing a standard curve. Detection of LNP cytotoxicity using CCK-8 kit (abbkine, China).

    Protein expression of LNP

    To detect the expression of LNP-delivered mRNA, DF-1 cells were seeded into 24-well plates at 200,000 cells/well. After 24 h, the cells were treated with LNPs containing S1 or N mRNA (1 µg per well), followed by another 24 h incubation. The untreated cells served as the control group. The expression of mRNA was detected by indirect immunofluorescence (IF) and western blotting assays using antibody, Flag, His, Myc, HA (abbkine, China) and IBV N (GeneTex, USA). To detect antigen expression following mRNA-LNP vaccination, DF-1 cells cultured in 24-well plates were incubated with the mRNA-LNP vaccine (1 µg per well) for 24 h. The cells were washed with cold PBS and lysed with RIPA lysis buffer (Beyotime). Equal amounts of protein were subjected to SDS-PAGE and electrotransferred onto nitrocellulose membranes (Pall, USA). The membranes were blocked in 5% nonfat milk for 2 h at room temperature and then incubated with monoclonal antibody. After three washes with PBST, the membranes were incubated with an HRP-conjugated goat anti-mouse antibody (Beyotime) for 1 h at room temperature. After washing, proteins were detected using an ECL kit (Tanon, China). The DF-1 cells were treated with mRNA-containing LNPs, washed three times with PBS, fixed for 20 min with 4% paraformaldehyde, and then permeabilized for 30 min with 0.1% Triton X-100. The fixed cells were incubated with monoclonal antibody for 2 h at 37℃. After three washes with PBS, the cells were incubated with an Alexa-Fluor-488-conjugated goat anti-mouse IgG (Beyotime) for 1 h at 37℃. The cell nuclei were stained with 0.01% 4′,6-diamidino-2-phenylindole (DAPI) for 10 min at room temperature. After washing again with PBS, fluorescence images were observed using a fluorescence microscope (Nikon, Japan).

    Safety and biodistribution of mRNA vaccines

    Twelve 7-day-old SPF chickens were divided into two groups of 6 chickens each, one group was immunized with 20 µg of each of the 5 mRNA vaccines, and the other group was immunized with 100 µl of sterile PBS, and the immunized group was observed for 14 consecutive days for any abnormalities of mental status, food and water intake, and other side-effects, etc. All the animals were dissected and the heart, spleen, lungs, kidneys, intestines and brain were collected for clinical anatomy and pathological section staining to assess the safety of the vaccine. Six 2-week-old SPF chickens were immunized using the mRNA vaccine, and two chickens were dissected and samples of plasma, heart, liver, spleen, lung, kidney, intestinal and muscle tissues (injection site) were collected at 24 h, 48 h and 72 h after immunization. The copy number of N gene in each organ tissue was detected by fluorescence quantitative PCR assay, and the expression of N protein in each organ tissue was detected by Western blot assay using IBV N protein monoclonal antibody. Three SPF chickens were injected intramuscularly with mRNA vaccine containing 10 µg of firefly luciferase (FLuc)-labeled mRNA, and another three SPF chickens were injected intramuscularly with 100 µl of PBS to serve as a negative control. After 24 h, SPF chickens were anesthetized using isoflurane, and injected intraperitoneally with PBS-diluted 3 mg of D-luciferin. Images were captured using an in vivo imaging system (PerkinElmer, USA) 10 min after fluorescein injection. The mice were subsequently euthanized and their livers and spleens were removed for in vitro imaging.

    Experimental design for the evaluation of immunogenicity of mRNA vaccine in SPF chickens

    96 one-day-old SPF chickens were randomly divided into 16 groups (n = 6), namely, GI19 monovalent mRNA vaccine 1 µg group, 5 µg group, 10 µg group, GI13 monovalent mRNA vaccine 1 µg group, 5 µg group, 10 µg group, GI7 monovalent mRNA vaccine 1 µg group, 5 µg group, 10 µg group, GVI1 monovalent mRNA vaccine 1µ g, 5 µg, and 10 µg groups, quadrivalent mRNA vaccine 1 µg, 5 µg, and 10 µg groups, and a PBS control group. The initial immunization was carried out at 1 day of age via the leg muscles, and a booster immunization was performed with the same immunization regimen 21 days after the first immunization. From 14 days after the first immunization, blood was collected weekly and serum was separated for the detection of antibodies. Peripheral blood lymphocytes were collected from three randomly selected chickens in each group 14 days after the first immunization and 14 days after the second immunization for T cell typing. Meanwhile, 14 days after the second immunization, two chickens in the high-dose 10 µg immunization group were randomly selected to isolate splenocytes for the detection of T cell proliferation and immune gene expression.

    ELISA for detecting IBV specific antibodies

    Beginning on the 14th day after immunization, sera were prepared from peripheral blood of 3 ~ 6 SPF chickens randomly collected from each group every 7 days and stored at −20℃ for reserve. IBV Antibody Detection Kit (ID.vet, France)was used to detect IBV-specific serum antibodies, and the S/P value and antibody titer of each sample were calculated according to the OD value of each sample, and the samples were judged to be positive for IBV antibodies when the S/P value of the samples was greater than 0.2.

    Flow cytometry

    Isolated lymphocytes were resuspended using 1640 complete medium supplemented with 10% serum, followed by cell counting, and the lymphocytes were adjusted to 1 × 106 cells according to the counting concentration and added to 1.5 ml EP tubes. Flow-through antibodies were prepared and each sample was resuspended with 100 µl of flow-through staining buffer, FITC anti-Chicken CD3 Antibody (2 µl/test), PE anti-Chichen CD4 Antibody (2 µl/test), APC anti-Chicken CD8a Antibody (2 µl/test), incubated for 30 min at 4 °C away from light, and set up one double-negative group and three single-staining group controls. After staining was completed, centrifugation was performed at 4000 rpm for 5 min, and 500 µl of flow-through staining buffer was added and resuspended after discarding the supernatant, washed twice, and 1 ml of flow-through staining buffer was resuspended for flow-through detection.

    CFSE lymphocyte proliferation assay

    Splenocytes were stained with 0.5mM CFSE (Invitrogen) in PBS for 5 min at room temperature. After being stained, the cells were washed three times with R10 medium and resuspended at a concentration of 2 × 107 cells/ml. The CFSE-stained cells were transferred to 24-well plates (500 ml per well) and stimulated with ConA (10 mg/ml, positive control) or IBV inactivated virus for 4 days in 41 °C and 5% CO2; a similar volume of R10 medium was added to the negative-control cells. After this incubation, the cells were harvested and stained with APC-conjugated mouse anti-chicken CD4 antibody, PE-conjugated mouse anti-chicken CD8a antibody, and Fixable Viability Dye eFluor 780 at 4 °C for 30 min and subsequently used for flow cytometry analyses. The percentage of proliferating CD4+T or CD8+T cells was determined based on the reduction in CFSE fluorescence over time.

    Cytokine analysis

    In each experimental group, two chickens were randomly taken from each group 14 days after the second immunization to collect peripheral blood lymphocytes and isolated spleens for grinding with a frozen tissue grinder, total RNA was extracted by TRizol, and RNA concentration was determined, and then the expression levels of immunity factors in peripheral blood lymphocytes and spleens were detected by relative quantification using SYBR Green fluorescence quantitative PCR. The primers used are shown in Table 4 [57].

    Table 4 Fluorescent quantitative PCR primers for immune-related genes

    Design of the SPF Chicken vaccination experiments and viral challenge study

    384 one-day-old SPF chickens were randomly divided into 12 groups, namely, GI19 monovalent mRNA vaccine 5 µg group and 10 µg group (n = 16), GI13 monovalent mRNA vaccine 5 µg group and 10 µg group (n = 16), GI7 monovalent mRNA vaccine 5 µg group and 10 µg group (n = 16), GVI1 monovalent mRNA vaccine 5 µg group and 10 µg group (n = 16), quadrivalent mRNA vaccine 5 µg group and 10 µg group (n = 64), IBV commercial inactivated vaccine group (n = 64) (M41 strain), and the PBS control group (n = 64). The initial immunization was carried out at 1 day of age via the leg muscles, and 21 days after the first immunization, each group was booster-immunized once by the same method, and the clinical performance of the chickens in each group was observed every day after immunization. 14 days after the booster immunization, blood was collected from 3 ~ 6 chickens from each group, and the serum was separated and used for IBV neutralizing antibody detection. At the same time, 2 chickens were randomly taken from each group to isolate spleen lymphocytes for IBV cellular immune response detection. Also 14 days after the booster immunization, the chickens in each group were divided into four strains to carry out the takedown test, and the chickens in each group were infected with 106 EID 50 strains of IBV 210197GXNN(GI19), 210127GXYL(GI13), 220198GDZC(GI7), and GZ701(GVI1) by nose-drops and eye-drops, respectively. 10 chickens in each group were randomly taken and numbered after the attack for clinical symptoms observation and survival rate counting, while the remaining chickens were used for sampling.

    Neutralization assay

    IBV neutralizing antibody levels were detected in chickens 14 days after secondary immunization using fixed virus dilution sera. To detect cross-neutralizing antibody levels in sera, IBV strains 210197GXNN (GI19), 210127GXYL (GI13), 220198GDZC (GI7), and GZ701 (GVI1) were used for each serum, respectively. The neutralizing potency of each serum was calculated according to the Reed-Muench method. Briefly, serum samples were inactivated in a 56 ℃ water bath for 30 min and then serially diluted 2-fold with sterile PBS. A sample (0.1 ml) of the diluted serum was incubated with an equal volume of IBV strain (200 EID50) at 37℃ for 1 h. Ten-day-old SPF embryonated chicken eggs were inoculated with the 0.2 ml virus-serum mixtures via the allantoic cavity route. 6 days later, the embryonated eggs were examined for IBV lesions, such as embryo dwarfing or stunting. Neutralizing antibody titers were calculated and are expressed here as the mean 6 standard deviation.

    IFN-γ ELISpot assay

    The ELISpot 96-well plates (Millipore, Eschborn, Germany) were coated with 5 mg/ml mouse-anti-ChIFN-γ (Invitrogen; Carlsbad, CA, USA) in PBS (pH 7.4) by overnight incubation at 4 °C. The plates were then washed with PBS and blocked with R10 medium (RPMI 1640 medium with 10% FBS). After the blocking IFN-γ detection buffer was discarded, 3.5 × 105 splenocytes from the experimental group were added to each well. The cells were stimulated for 24 h in the presence of either R10 medium (negative control), mitogen PMA (5 mg/ml, positive control), IBV UV-inactivated virus at 41℃ and 5% CO2. Subsequently, the plates were washed with PBST (PBS supplemented with 0.05% Tween 20) and incubated with 1 mg/ml biotin-conjugated mouse anti-ChIFN-γ (Invitrogen) for 1 h at room temperature. Plates were again washed with PBST and then incubated with horseradish peroxidase (HRP)-conjugated streptavidin (BD Bioscience, Franklin Lake, NJ, USA) for 1 h at room temperature. Spots were developed via incubation with an 3-amino-9-ethylcarbazole (AEC) substrate set (BD Bioscience) and counted by using an ELISpot plate reader (Immunospot Analyzer; Cellular Technology Ltd., Shaker Heights, OH, USA). Peptide-specific T-cell frequencies are expressed in this manuscript as the number of spot-forming cells per 106 splenocytes.

    IL-4 and IFN-γ detection

    The cell culture supernatants (from the abovementioned lymphocyte proliferation assay) were collected after 72 h of stimulation with the IBV UV-inactivated virus. The IL-4 and IFN-γ levels in the supernatants were evaluated by using commercial chicken IL-4 and IFN-γ ELISA Kits (Meibiao, China) according to the manufacturers instructions. The cytokine concentrations were calculated according to the standard curve obtained for each ELISA plate.

    Evaluation of clinical signs and histopathological analysis

    The clinical signs were scored as follows: 0 for normal; 1 for slight shaking, slight nasal discharge, and slight lacrimation; 2 for depression, watery feces, and sneezing or coughing; 3 for heavy depression, heavy nasal discharge, and tracheal rales or mouth breathing; and 4 for death [67]. After the 7th day of attack, lungs, kidneys, and bursae of chickens (n = 2) from each group were collected and fixed in formalin for histological examination. The dehydrated tissues were treated with xylene, embedded in paraffin wax, sliced, and mounted on slides.

    Tracheal ciliary activity scores and electron microscopic observations

    On days 5 and 7 after the attack, tracheal tissues from chickens in each group (n = 2) were collected for tracheal ciliary activity scoring and preparation of electron microscopy samples to observe ciliary damage. To evaluate ciliostasis activity, nine tracheal rings per chicken were prepared (three rings each from the upper, middle, and lower parts of the trachea) and placed in 96-well plates containing DMEM with 10% FBS. The ciliary activity was examined under a low-power microscope, and each ring was scored as follows: 0 for 100% of the tracheal cilia showing movement; 1 for 75–100% of the tracheal cilia showing movement; 2 for 50–75% of the cilia showing movement; 3 for 25–50% of the tracheal cilia showing movement; and 4 for 0–25% of the tracheal cilia showing movement [67]. The average ciliostasis score was calculated for each group.

    Quantification of IBV RNA by quantitative real-time PCR

    Trachea, lungs and kidneys and bursa of each group of chickens (n = 2) were collected on days 5 and 7 after tapping and RNA was extracted. Throat swabs and cloacal swabs of each group of chickens (n = 5) were collected on days 3, 5,7 and 9 after tapping and preserved in sterile double-antibiotic PBS and subsequently extracted for RNA. Extracted RNAs were assayed using fluorescent quantitative PCR with the following primers: F: CTGCCAAGGGTGCTGATGTAA, R:CTTCCACTCCTACCACGATTCA, followed by calculation of IBV N gene copy number according to the standard curve equation (y=−3.255x + 36.806).

    Statistical analysis

    Data were analyzed using GraphPad Prism 10 (GraphPad Software). The values shown in the graphs are presented as the mean ± SEM. Statistical differences between groups were analyzed using two-tailed unpaired t tests for single factor analysis or two-way ANOVA statistical tests for double factor analysis. P values are denoted as follows: ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. All experiments were conducted with at least 3 independent replicates.

    [ad_2]

    Source link

    animals avian based consensus Coronavirus genes infections Journal Lipid multiple Nanobiotechnology nanoparticlesmRNA Protect sequences Viral
    Follow on Google News Follow on Flipboard
    Share. Facebook Twitter Pinterest LinkedIn Tumblr Email Copy Link
    tonirufai
    big tee tech hub
    • Website

    Related Posts

    Nanowire Sponge Cleans Water by Killing Microbes and Breaking Down Pollutants

    May 26, 2026

    Influence of the local environment on mid-infrared photothermal contrast

    May 25, 2026

    Moving past size in nanoplastics research

    May 24, 2026
    Add A Comment
    Leave A Reply Cancel Reply

    Editors Picks

    Zane Maldonado LattePanda IOTA-Powered CG Deck Moves from Dream to Engineering Prototype

    May 26, 2026

    How Agentic AI Is Changing Network Traffic: Cisco Report

    May 26, 2026

    Apple’s incredible AirPods Pro 3 drop back below $200

    May 26, 2026

    A practical guide for platform teams managing shared AI deployments

    May 26, 2026
    Timer Code
    15 Second Timer for Articles
    20
    About Us
    About Us

    Welcome To big tee tech hub. Big tee tech hub is a Professional seo tools Platform. Here we will provide you only interesting content, which you will like very much. We’re dedicated to providing you the best of seo tools, with a focus on dependability and tools. We’re working to turn our passion for seo tools into a booming online website. We hope you enjoy our seo tools as much as we enjoy offering them to you.

    Don't Miss!

    Zane Maldonado LattePanda IOTA-Powered CG Deck Moves from Dream to Engineering Prototype

    May 26, 2026

    How Agentic AI Is Changing Network Traffic: Cisco Report

    May 26, 2026

    Subscribe to Updates

    Get the latest technology news from Bigteetechhub about IT, Cybersecurity and Big Data.

      • About Us
      • Contact Us
      • Disclaimer
      • Privacy Policy
      • Terms and Conditions
      © 2026 bigteetechhub.All Right Reserved

      Type above and press Enter to search. Press Esc to cancel.